Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 3835841
End position: 3835894
Length: 54

DNA sequence
>NC_007613, from 3835841 to 3835894 (54 bp); Shigella boydii Sb227 GGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3835802-3837025	Sequence	SBO_3814 hemX uroporphyrinogen III C-methyltransferase (Protein is coded in complementary strand; from 3837025 to 3835802)