Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 37913
End position: 37936
Length: 24

DNA sequence
>NC_007613, from 37913 to 37936 (24 bp); Shigella boydii Sb227 CTGGCGGTGGCGCTGTCGATGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 36831-38693	Sequence	SBO_0036 kefC glutathione-regulated potassium-efflux system protein KefC