Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 3549910
End position: 3549933
Length: 24

DNA sequence
>NC_007613, from 3549910 to 3549933 (24 bp); Shigella boydii Sb227 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3549470-3550372	Sequence	SBO_3541 dppC dipeptide transporter (Protein is coded in complementary strand; from 3550372 to 3549470)