Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 1777065
End position: 1777109
Length: 45

DNA sequence
>NC_007613, from 1777065 to 1777109 (45 bp); Shigella boydii Sb227 GCCACCACCGCCTCCGCCACCCGCGCCGCCGCCAGCACCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1777060-1778955	Sequence	SBO_1798 yciQ hypothetical protein (Protein is coded in complementary strand; from 1778955 to 1777060)