Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 1081055
End position: 1081082
Length: 28

DNA sequence
>NC_007613, from 1081055 to 1081082 (28 bp); Shigella boydii Sb227 ACCAGCAACCAGCGACCGGCAGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1080776-1082434	Sequence	SBO_1070 fliF flagellar MS-ring protein (Protein is coded in complementary strand; from 1082434 to 1080776)