Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 621694
End position: 621738
Length: 45

DNA sequence
>NC_007613, from 621694 to 621738 (45 bp); Shigella boydii Sb227 AGAAAGCAGCGGCAGAAAAAGCCGCCGCAGACAAAAAAGCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 620935-622176	Sequence	SBO_0598 tolA cell envelope integrity inner membrane protein TolA