Sequence retrieval

Genome: Shigella boydii Sb227
Start position: 4385877
End position: 4385900
Length: 24

DNA sequence
>NC_007613, from 4385877 to 4385900 (24 bp); Shigella boydii Sb227 GCAGCAGCATCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4385273-4386466	Sequence	SBO_4336 imm membrane transport protein (Protein is coded in complementary strand; from 4386466 to 4385273)