Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9312
Start position: 620274
End position: 620321
Length: 48

DNA sequence
>NC_007577, from 620274 to 620321 (48 bp); Prochlorococcus marinus str. MIT 9312 CTTTATTTGACATTTTAGTTGACATTTTTTTTGACATTTTATTTGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 619565-620311	Sequence	PMT9312_0659 - hypothetical protein (Protein is coded in complementary strand; from 620311 to 619565)