Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9312
Start position: 1642290
End position: 1642316
Length: 27

DNA sequence
>NC_007577, from 1642290 to 1642316 (27 bp); Prochlorococcus marinus str. MIT 9312 AAAAAGTAGAAAAAGTAGAAAAAGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1641066-1642805	Sequence	PMT9312_1750 - DNA polymerase III, tau subunit