Sequence retrieval

Genome: Thiomicrospira crunogena XCL-2
Start position: 2340017
End position: 2340040
Length: 24

DNA sequence
>NC_007520, from 2340017 to 2340040 (24 bp); Thiomicrospira crunogena XCL-2 CCATGTCCATTTCCATGCCCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2339197-2341197	Sequence	Tcr_2116 - copper-resistance protein CopA (Protein is coded in complementary strand; from 2341197 to 2339197)