Sequence retrieval

Genome: Thiomicrospira crunogena XCL-2
Start position: 1601812
End position: 1601865
Length: 54

DNA sequence
>NC_007520, from 1601812 to 1601865 (54 bp); Thiomicrospira crunogena XCL-2 GCGCAGGCTCTGGTTCAGGCGCAGGCTCTGGTTCAGGCGCAGGCTCTGGTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1600749-1602131	Sequence	Tcr_1483 - hypothetical protein (Protein is coded in complementary strand; from 1602131 to 1600749)