Sequence retrieval

Genome: Thiomicrospira crunogena XCL-2
Start position: 1497638
End position: 1497662
Length: 25

DNA sequence
>NC_007520, from 1497638 to 1497662 (25 bp); Thiomicrospira crunogena XCL-2 ATTCAATTGAATTCGATTAAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1496391-1498319	Sequence	Tcr_1383 - Hpt sensor hybrid histidine kinase (Protein is coded in complementary strand; from 1498319 to 1496391)