Sequence retrieval

Genome: Chlorobium chlorochromatii CaD3
Start position: 2265136
End position: 2265159
Length: 24

DNA sequence
>NC_007514, from 2265136 to 2265159 (24 bp); Chlorobium chlorochromatii CaD3 TCACTATCACTTTCGCTATCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2264365-2265429	Sequence	Cag_1746 - MesJ protein (Protein is coded in complementary strand; from 2265429 to 2264365)