Sequence retrieval

Genome: Chlorobium chlorochromatii CaD3
Start position: 204990
End position: 205025
Length: 36

DNA sequence
>NC_007514, from 204990 to 205025 (36 bp); Chlorobium chlorochromatii CaD3 TTTTACTACCCCACTTACTACCCCATTTACTGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 204766-205824	Sequence	Cag_0182 - Fic family protein (Protein is coded in complementary strand; from 205824 to 204766)