Sequence retrieval

Genome: Chlorobium chlorochromatii CaD3
Start position: 203833
End position: 203856
Length: 24

DNA sequence
>NC_007514, from 203833 to 203856 (24 bp); Chlorobium chlorochromatii CaD3 TAGGTTTGTAGGTTTGTAGGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 202983-203834	Sequence	Cag_0180 - prephenate dehydratase (Protein is coded in complementary strand; from 203834 to 202983)