Sequence retrieval

Genome: Chlorobium chlorochromatii CaD3
Start position: 1584925
End position: 1584978
Length: 54

DNA sequence
>NC_007514, from 1584925 to 1584978 (54 bp); Chlorobium chlorochromatii CaD3 TGTTCAAGTCTTGTTTGCTGTTCAAGTCTTGTTTGCTGTTCAAGTCTTGTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1584910-1585443	Sequence	Cag_1191 - hypothetical protein (Protein is coded in complementary strand; from 1585443 to 1584910)