Sequence retrieval

Genome: Chlorobium chlorochromatii CaD3
Start position: 1531591
End position: 1531653
Length: 63

DNA sequence
>NC_007514, from 1531591 to 1531653 (63 bp); Chlorobium chlorochromatii CaD3 TTGTAGGGGCAGATATGGAATCTATAGGGGCAGATATGGAATCTATAGGGGCAGATATGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1531344-1531922	Sequence	Cag_1136 - hypothetical protein (Protein is coded in complementary strand; from 1531922 to 1531344)