Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 539211
End position: 539237
Length: 27

DNA sequence
>NC_007498, from 539211 to 539237 (27 bp); Pelobacter carbinolicus DSM 2380 ATATGCTCGATATGGTCGCTATGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 539013-541289	Sequence	Pcar_0442 metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase