Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 448967
End position: 449008
Length: 42

DNA sequence
>NC_007498, from 448967 to 449008 (42 bp); Pelobacter carbinolicus DSM 2380 CACTCCTCACTCCTCACTCCTCACTCCTCACTCCTCACTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 449002-449676	Sequence	Pcar_0360 - two component signal transduction response regulator (Protein is coded in complementary strand; from 449676 to 449002)