Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 3475885
End position: 3475908
Length: 24

DNA sequence
>NC_007498, from 3475885 to 3475908 (24 bp); Pelobacter carbinolicus DSM 2380 ATCGATATCGGTCTCGATATCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3475550-3476209	Sequence	Pcar_2966 - periplasmic or secreted lipoprotein OsmY (Protein is coded in complementary strand; from 3476209 to 3475550)