Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 2764199
End position: 2764243
Length: 45

DNA sequence
>NC_007498, from 2764199 to 2764243 (45 bp); Pelobacter carbinolicus DSM 2380 ACCGGTTCTTCCACTACCGGTTCTTCCACTACCGGTTCTTCCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2763281-2764699	Sequence	Pcar_2354 ftsY cell division membrane protein (Protein is coded in complementary strand; from 2764699 to 2763281)