Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 2164929
End position: 2164952
Length: 24

DNA sequence
>NC_007498, from 2164929 to 2164952 (24 bp); Pelobacter carbinolicus DSM 2380 CATGGCCATGGCCTTGGCCATGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2164201-2165229	Sequence	Pcar_1850 - DNA-binding/iron metalloprotein/AP endonuclease (Protein is coded in complementary strand; from 2165229 to 2164201)