Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 2122593
End position: 2122628
Length: 36

DNA sequence
>NC_007498, from 2122593 to 2122628 (36 bp); Pelobacter carbinolicus DSM 2380 GCTGACTTGGGGGGTGACTTGAGGTCTGACTTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2122375-2123049	Sequence	Pcar_1812 - hypothetical protein (Protein is coded in complementary strand; from 2123049 to 2122375)