Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 2096826
End position: 2096853
Length: 28

DNA sequence
>NC_007498, from 2096826 to 2096853 (28 bp); Pelobacter carbinolicus DSM 2380 ACAAATGACAAGTGACAGATGACAAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2095835-2097340	Sequence	Pcar_1794 cpsB mannose-1-phosphate guanylyltransferase (Protein is coded in complementary strand; from 2097340 to 2095835)