Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 1711993
End position: 1712028
Length: 36

DNA sequence
>NC_007498, from 1711993 to 1712028 (36 bp); Pelobacter carbinolicus DSM 2380 GCTACGGTTACGGTTACGGCTACGGTTACGGCTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1709689-1712103	Sequence	Pcar_1464 - exopolysaccharide biosynthesis protein