Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 1405320
End position: 1405373
Length: 54

DNA sequence
>NC_007498, from 1405320 to 1405373 (54 bp); Pelobacter carbinolicus DSM 2380 CGCTGCGGAATCGAATGATGCTGCCGAACCGAATGATGCTGCCGAACCGAATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1404683-1407346	Sequence	Pcar_1197 cheA chemotaxis protein histidine kinase