Sequence retrieval

Genome: Pelobacter carbinolicus DSM 2380
Start position: 107196
End position: 107219
Length: 24

DNA sequence
>NC_007498, from 107196 to 107219 (24 bp); Pelobacter carbinolicus DSM 2380 GCAGGAGCATGAGCAGAAGCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 106325-107248	Sequence	Pcar_0090 - parvulin-like peptidyl-prolyl isomerase (Protein is coded in complementary strand; from 107248 to 106325)