Sequence retrieval

Genome: Pseudoalteromonas haloplanktis TAC125
Start position: 368189
End position: 368233
Length: 45

DNA sequence
>NC_007481, from 368189 to 368233 (45 bp); Pseudoalteromonas haloplanktis TAC125 GAAGCTGAGCGAGCAGAAGCTGAGCGAGCAGAAGCTGAGCGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 367425-369380	Sequence	PSHAa0354 ftsY cell division transporter substrate-binding protein