Sequence retrieval

Genome: Pseudoalteromonas haloplanktis TAC125
Start position: 2809936
End position: 2809962
Length: 27

DNA sequence
>NC_007481, from 2809936 to 2809962 (27 bp); Pseudoalteromonas haloplanktis TAC125 ACCACCGTCACCACCGTCACCACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2808908-2810065	Sequence	PSHAa2654 obgE GTPase ObgE (Protein is coded in complementary strand; from 2810065 to 2808908)