Sequence retrieval

Genome: Pseudoalteromonas haloplanktis TAC125
Start position: 2734909
End position: 2734956
Length: 48

DNA sequence
>NC_007481, from 2734909 to 2734956 (48 bp); Pseudoalteromonas haloplanktis TAC125 GTTATTAGTTAGGTTATTAGTTAGGTTATTAGTTAGGTTATTAGTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2734469-2735314	Sequence	PSHAa2589 cpdA cyclic 3',5'-adenosine monophosphate phosphodiesterase (Protein is coded in complementary strand; from 2735314 to 2734469)