Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1681728
End position: 1681787
Length: 60

DNA sequence
>NC_007297, from 1681728 to 1681787 (60 bp); Streptococcus pyogenes MGAS5005 CCATCTCCAGACCAGTCATCTTCAGGCCAGTCATCTCCAGACCAGTCATCTCCAGACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1680969-1681910	Sequence	M5005_Spy_1718 sic1.01 inhibitor of complement protein (Protein is coded in complementary strand; from 1681910 to 1680969)