Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1675487
End position: 1675522
Length: 36

DNA sequence
>NC_007297, from 1675487 to 1675522 (36 bp); Streptococcus pyogenes MGAS5005 TTTTTCTGGTTTAGTTTCTGGTTTTTTATCTGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1675257-1678751	Sequence	M5005_Spy_1715 scpA C5A peptidase (Protein is coded in complementary strand; from 1678751 to 1675257)