Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 327806
End position: 327835
Length: 30

DNA sequence
>NC_007297, from 327806 to 327835 (30 bp); Streptococcus pyogenes MGAS5005 ATGGCAAATAAAGGCAAGTAATGGCTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 327182-328108	Sequence	M5005_Spy_0321 fhuG ferrichrome transporter permease (Protein is coded in complementary strand; from 328108 to 327182)