Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1568312
End position: 1568341
Length: 30

DNA sequence
>NC_007297, from 1568312 to 1568341 (30 bp); Streptococcus pyogenes MGAS5005 TTCTTCATCTTCTTCATCTTCTTCGTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1568301-1568876	Sequence	M5005_Spy_1611 rpoE DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 1568876 to 1568301)