Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1165633
End position: 1165662
Length: 30

DNA sequence
>NC_007297, from 1165633 to 1165662 (30 bp); Streptococcus pyogenes MGAS5005 ACTGTCATGCACTGTTATTCACTGTCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1165658-1166077	Sequence	M5005_Spy_1197 - phage protein (Protein is coded in complementary strand; from 1166077 to 1165658)