Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1594369
End position: 1594395
Length: 27

DNA sequence
>NC_007297, from 1594369 to 1594395 (27 bp); Streptococcus pyogenes MGAS5005 CTTTTTCCACCTTTTCCACTTATTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1593724-1595349	Sequence	M5005_Spy_1630 salB serine (threonine) dehydratase (Protein is coded in complementary strand; from 1595349 to 1593724)