Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1358891
End position: 1358917
Length: 27

DNA sequence
>NC_007297, from 1358891 to 1358917 (27 bp); Streptococcus pyogenes MGAS5005 TTTTCAAACTTTTCAAAGTTTTCAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1358639-1359556	Sequence	M5005_Spy_1385 glyQ glycyl-tRNA synthetase subunit alpha (Protein is coded in complementary strand; from 1359556 to 1358639)