Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1182313
End position: 1182339
Length: 27

DNA sequence
>NC_007297, from 1182313 to 1182339 (27 bp); Streptococcus pyogenes MGAS5005 ATCTTCTTCATCTTCTTCATTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1181717-1182658	Sequence	M5005_Spy_1227 - hypothetical protein (Protein is coded in complementary strand; from 1182658 to 1181717)