Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 725032
End position: 725055
Length: 24

DNA sequence
>NC_007297, from 725032 to 725055 (24 bp); Streptococcus pyogenes MGAS5005 ACAGCACCAGCAACAGTAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 724933-725109	Sequence	M5005_Spy_0721 - hypothetical protein (Protein is coded in complementary strand; from 725109 to 724933)