Sequence retrieval

Genome: Streptococcus pyogenes MGAS5005
Start position: 1083442
End position: 1083465
Length: 24

DNA sequence
>NC_007297, from 1083442 to 1083465 (24 bp); Streptococcus pyogenes MGAS5005 CTTCATTTTCATCCTCATGTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1083414-1085792	Sequence	M5005_Spy_1109 inlA internalin protein (Protein is coded in complementary strand; from 1085792 to 1083414)