Sequence retrieval

Genome: Blochmannia pennsylvanicus str. BPEN (candidatus)
Start position: 455255
End position: 455281
Length: 27

DNA sequence
>NC_007292, from 455255 to 455281 (27 bp); Blochmannia pennsylvanicus str. BPEN (candidatus) AAGCTGTTCAAGGTGTTCAATCTGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 455118-455906	Sequence	BPEN_387 kdsB 3-deoxy-manno-octulosonate cytidylyltransferase (Protein is coded in complementary strand; from 455906 to 455118)