Sequence retrieval

Genome: Blochmannia pennsylvanicus str. BPEN (candidatus)
Start position: 362078
End position: 362110
Length: 33

DNA sequence
>NC_007292, from 362078 to 362110 (33 bp); Blochmannia pennsylvanicus str. BPEN (candidatus) GGTATTAAAACAGTATTAATACCGTATGAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 359892-362255	Sequence	BPEN_307 lon DNA-binding ATP-dependent protease La