Sequence retrieval

Genome: Blochmannia pennsylvanicus str. BPEN (candidatus)
Start position: 349092
End position: 349121
Length: 30

DNA sequence
>NC_007292, from 349092 to 349121 (30 bp); Blochmannia pennsylvanicus str. BPEN (candidatus) AAAAAAATAACAAAAAAAACCAAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 348625-349209	Sequence	BPEN_298 gmhB D,D-heptose 1,7-bisphosphate phosphatase