Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 974308
End position: 974334
Length: 27

DNA sequence
>NC_007205, from 974308 to 974334 (27 bp); Pelagibacter ubique HTCC1062 AATTTTTTTAATTTTCTTAATTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 972986-975037	Sequence	SAR11_0993 recG ATP-dependent DNA helicase RecG (Protein is coded in complementary strand; from 975037 to 972986)