Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 825372
End position: 825407
Length: 36

DNA sequence
>NC_007205, from 825372 to 825407 (36 bp); Pelagibacter ubique HTCC1062 TTTTTTTAATTTTTTTTACAATTTTTTTGTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 824837-825637	Sequence	SAR11_0855 - peptidase (Protein is coded in complementary strand; from 825637 to 824837)