Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 764337
End position: 764360
Length: 24

DNA sequence
>NC_007205, from 764337 to 764360 (24 bp); Pelagibacter ubique HTCC1062 ATATTTTTATATCTTTATTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 763955-764959	Sequence	SAR11_0789 cysK cysteine synthase A (Protein is coded in complementary strand; from 764959 to 763955)