Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 702279
End position: 702308
Length: 30

DNA sequence
>NC_007205, from 702279 to 702308 (30 bp); Pelagibacter ubique HTCC1062 ATTTTAGAAAATTTTATTAAATTTTTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 701796-702374	Sequence	SAR11_0718 purN phosphoribosylglycinamide formyltransferase (Protein is coded in complementary strand; from 702374 to 701796)