Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 524931
End position: 524960
Length: 30

DNA sequence
>NC_007205, from 524931 to 524960 (30 bp); Pelagibacter ubique HTCC1062 TTTTTTAAAAGTTTTAAAAAATTTTTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 524613-525977	Sequence	SAR11_0532 - FAD oxidase family protein (Protein is coded in complementary strand; from 525977 to 524613)