Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 338017
End position: 338040
Length: 24

DNA sequence
>NC_007205, from 338017 to 338040 (24 bp); Pelagibacter ubique HTCC1062 TTAAAACTAAAATTAATATTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 337766-338200	Sequence	SAR11_0347 - cytochrome functioning/assembly related protein