Sequence retrieval

Genome: Pelagibacter ubique HTCC1062
Start position: 258356
End position: 258379
Length: 24

DNA sequence
>NC_007205, from 258356 to 258379 (24 bp); Pelagibacter ubique HTCC1062 CTGCTGCTGGTGCTGCTTCTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 258283-258816	Sequence	SAR11_0255 rpsP 30S ribosomal protein S16 (Protein is coded in complementary strand; from 258816 to 258283)